Resolving DNA origami structural integrity and pharmacokinetics in vivo


DNA origami preparation

The scaffold DNA p7560 was produced utilizing a phage-amplification-in-bacteria protocol described in earlier work54. Staple oligonucleotides, each with and with out the 5′-end phosphate modifications, had been sourced from Built-in DNA Applied sciences (Supplementary Information 1). The Wrod and Wbarrel DNA origami buildings had been assembled in 100-µl reactions containing remaining concentrations of 20 nM of p7560 scaffold, 100 nM of every staple strand and 1× PBS. The Lrod DNA origami construction was assembled in 100-µl reactions containing remaining concentrations of 20 nM of p7560 scaffold, 150 nM of every LSP staple, 100 nM of every of the opposite staple strands, 5 mM of Tris, 1 mM of EDTA and eight mM of MgCl2. The folding response for all origamis began with a fast warmth denaturation at 60 °C, after which step by step cooled from 60 °C to 24 °C over 14 h on a PCR thermal cycler. The surplus staples had been eliminated by repeated cycles of dilution and centrifugation with 1× PBS for Wrod and Wbarrel, or 1× PBS and 5 mM of MgCl2 for Lrod, utilizing 100-kDa Amicon Extremely Centrifugal Filters (Millipore) at 14,000g for 1 min. Concurrently, the samples had been concentrated to the wanted remaining focus, which was decided by UV 260 absorbance utilizing a Nanodrop 2000 spectrophotometer (Thermo Fisher). To coat the DNA origamis with oligolysine (Ok10)-PEG5K copolymer, the buildings had been incubated with the Ok10-PEG5K copolymer at an N:P ratio of 1:1 for 30 min at room temperature.

UV irradiation

For UV crosslinking the Lrod, the samples had been irradiated in 1× PBS and 5 mM of MgCl2 with a UV mild pointer for two h on ice utilizing a 300-W xenon mild supply (MAX-303, Asahi Spectra) with a high-transmission bandpass filter centred at 310 nm (XAQA310, Asahi Spectra).

Gel electrophoresis

The folding high quality of the origami buildings was assessed with 2% agarose gels in 0.5× Tris-borate-EDTA (TBE) buffer supplemented with 10 mM of MgCl2 and 0.5 mg ml−1 of ethidium bromide. Gel electrophoresis was performed at 90 V for 3 h on an ice tub utilizing 0.5× TBE with 10 mM of MgCl2 because the operating buffer. The gels had been imaged utilizing a GE LAS 4000 imager.

Origami imaging with cyro-electron microscopy

The cryogenic specimens had been ready utilizing a Vitrobot Mk4 and a glow-discharged Quantifoil R 1.2/1.3 gold grid. We utilized 3 µl of concentrated (>500 nM) DNA origami resolution, incubated at 100% humidity for 1–5 min and flash frozen in liquid ethane. Grids had been saved in liquid nitrogen till picture assortment with a Krios G3i transmission electron microscopy (TEM) machine at 300 kV. Photographs had been captured within the energy-filtered transmission electron microscopy (EFTEM) selected-area (SA) mode at ×81k with a 10-eV slit utilizing K3 BioQuantum, with an publicity of 4.4 s per 45 frames at a dose charge of 0.90 e Å−2 per body.

TEM

DNA origami samples (3 µl, 5–10 nM) had been utilized to glow-discharged formvar/carbon-coated copper grids (FCF400-Cu, EMS) and incubated for 1.5 min. Extra pattern was blotted away utilizing filter paper. The grids had been then instantly stained with 15 µl of two% (w/v) uranyl formate for 40 s and blotted dry. To neutralize the acidic pH of the uranyl formate resolution, 8 µl of 1-M NaOH was added to 400 µl of two% uranyl formate, adopted by centrifugation at 16,000g for five min earlier than use. Adverse-stained samples had been imaged utilizing a Talos L120C G2 TEM machine (Thermo Fisher Scientific) operated at 120 kV. Photographs had been acquired at ×57,000 magnification utilizing a Ceta-D detector.

Blood samples from mice and moral allow

All animal dealing with and experimental procedures had been performed in compliance with native ethics tips and obtained approval from the Stockholm Animal Experimentation Ethics Committee (Stockholms djurförsöksetiska nämnd, Dnr 16041-2019). Mice had been home in ventilated cages beneath particular pathogen-free situations with a 12-h mild/darkish cycle, at an ambient temperature of twenty-two ± 2 °C and relative humidity of 45%–65%. Animals had free entry to straightforward chow and water advert libitum. For every BALB/c mouse (Mus musculus, substrain BALB/cAnNCrl, 6–8 weeks outdated, from Charles River Laboratories), a quantity of 100 μl with 50 nM of DNA origami buildings was administered both intravenously or intraperitoneally. Subsequently, 2 μl of blood was collected from the tail tip at every designated time level and instantly utilized for proximity ligation reactions. No statistical strategies had been used to predetermine the pattern sizes, however our pattern sizes are much like these reported in earlier publications analyzing the DNA origami pharmacokinetics and in vivo nanostructure stability23.

Proximity ligation on DNA origami in blood

To conduct the ligation response, 1 μl of blood was added to a response combination consisting of 4 μl of T4 ligase (New England Biolabs, M0202), 4 μl of 10X T4 DNA Ligase Buffer (New England Biolabs, B0202S) and 31 μl of nuclease-free water. The response was incubated at room temperature for 10 min, adopted by a denaturation step at 95 °C for 10 min. Subsequently, the samples had been centrifuged, and the supernatants had been retained for downstream analyses, together with PCR, qPCR and library preparation for Illumina sequencing.

PCR and gel assays

For the pooled PCR amplification of the ligated LSPs of the rod and the barrel origami buildings, one set of ahead (CATGTCCGACGTCCTCCAC) and reverse (CTCACTGCTGCACCACACAC) PCR primers was used. For the amplification of the DNA scaffold, two primer pairs (ahead 1, ACTCGTTCTGGTGTTTCTCG; reverse 1, TGAAAGAGGACAGATGAACGG; ahead 2, CTGGCTCGAAAATGCCTCT; reverse 2, ACCAGTATAAAGCCAACGCT) concentrating on completely different areas had been used. Every PCR response had a complete quantity of fifty μl consisting of 20 μl of the goal pattern, 25 μl of two× Platinum II Sizzling-Begin PCR Grasp Combine (Invitrogen), 0.15 μM of ahead and reverse primers, and nuclease-free water. On a thermocycler, 25 cycles of PCR reactions had been then carried out based on the product directions of the Platinum II Sizzling-Begin PCR Grasp Combine. The amplified samples had been analysed by denaturing PAGE gel of 10% 19:1 acrylamide:bisacrylamide (BioRad), 8 M of urea and 1× TBE. The samples had been blended with formamide and run for 30 min at 300 V. The gels had been post-stained with SYBR Gold (Invitrogen) and imaged utilizing a GE LAS 4000 imager.

Library preparation, quantification and sequencing

The PCR product was purified utilizing AMPure XP beads (Beckman Coulter, A63881) at 2× extra. The ensuing product was ready right into a library utilizing the xGen DNA Lib Prep MC UNI 96rxn equipment (Built-in DNA Applied sciences, 10009820) together with xGen-UDI-UMI adaptors (Built-in DNA Applied sciences, 10005903). The library was subjected to eight cycles of PCR following the producer’s protocol, and purified utilizing AMPure XP beads at 0.8× extra, resuspended in low-EDTA TE buffer equipped with the equipment. The library dimension and quantity had been estimated utilizing the Invitrogen Quant-iT Qubit dsDNA HS Assay Package (Thermo Fisher, Q32851) and Excessive Sensitivity Bioanalyzer chips (Agilent, 5067-4626). The library was diluted to 4 nM, pooled and loaded onto a NextSeq 550 Excessive Output Package v. 2.5 (75 cycles; Illumina, 20024906) based on the producer’s protocol. Sequencing reads had been assigned to particular pairs by aligning them to the sequences of the ligation pairs utilizing bowtie2 with default settings and preserving the very best alignment per pair. The alignment was additional analysed with in-house scripts.

qPCR

Following the producer’s directions, every 20 μl of the qPCR response combine contained 7.4 μl of the pattern, 10 μl of Luna Common qPCR Grasp Combine (New England Biolabs), 0.25 μM of the ahead primer, 0.25 μM of the reverse primer and 1.6 μl of nuclease-free water. The response consisted of an preliminary denaturation step of 1 min at 95 °C adopted by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. The analyte pattern was both from the blood of in vivo experiments or DNA origami ligated in vitro. To generate the usual curves of every ligated LSP, the DNA origami construction was ligated in vitro and diluted in 1× PBS to a remaining quantity of 10–1 million molecules per focus level, and run in parallel with the corresponding in vivo pattern. The primers used for the qPCR evaluation are listed in Supplementary Information 1. The recorded CT values had been used for plotting the usual curves and to calculate the copy variety of the corresponding analytes run on the identical 96-well plate.

Information assertion

Mice had been randomly assigned to completely different experimental teams to attenuate potential bias. No particular randomization algorithm was used, however group allocation was carried out in an unbiased method based mostly on animal availability on the time of remedy. No animals or information factors had been excluded from the analyses. All information collected had been included within the reported outcomes. Information assortment and evaluation weren’t carried out blind to the situations of the experiments. Information distribution was assumed to be regular, however this was not formally examined.

Pharmacokinetics mannequin of dynamic in vivo origami distribution

The dynamic distribution of DNA origami in vivo, injected both intravenously or into the peritoneal cavity, was modelled utilizing a system of bizarre completely different equations that had been solved to acquire focus values as a operate of time. The mannequin was designed to seize the points of absorption from the peritoneal cavity into the bloodstream and subsequent elimination from the bloodstream as a operate of time from the preliminary injection. The mannequin was then fitted to the experimental information, independently for every particular person LSP trajectory, to acquire parameter values and goodness-of-fit checks.

Experimental information had been preprocessed earlier than becoming, together with a cleansing step to take away NaN values, and by subtracting a baseline worth from every trajectory. The baseline was decided, in every case, by taking the imply of the final time factors beneath the belief that the sign had stabilized by that time. Adverse values ensuing from baseline subtraction had been clipped to zero.

The i.v. situations by which DNA origami was immediately injected into the blood takes the type of a single-compartment mannequin consisting of equation (4), repeated right here:

$$frac{{rm{d}}{C}_{mathrm{blood}}}{{rm{d}}t}=-{okay}_{{rm{e}}}{C}_{mathrm{blood}},$$

(4)

the place ({C}_{mathrm{blood}}) is in pM and ({okay}_{{rm{e}}}) is in min−1, representing the method by which DNA origami is degraded or faraway from the bloodstream.

For the i.p. situations, a two-compartment mannequin was used consisting of the next differential equations, repeated right here:

$$frac{{rm{d}}{C}_{{peri}}}{{rm{d}}t}=-{okay}_{{rm{a}}}{C}_{mathrm{peri}}$$

(5)

and

$$frac{{rm{d}}{C}_{mathrm{blood}}}{{rm{d}}t}={okay}_{{rm{a}}}left(frac{{V}_{mathrm{peri}}}{{V}_{mathrm{blood}}}proper){C}_{mathrm{peri}}-{okay}_{{rm{e}}}{C}_{mathrm{blood}}.$$

(6)

Right here ({V}_{mathrm{peri}}) and ({V}_{mathrm{blood}}) are assumed to be (0.5times {10}^{-3}l) and (1.5times {10}^{-3}l), respectively.

Fixing equation (4), a first-order linear differential equation yields the method for blood DNA origami focus for the case of i.v. injections:

$${C}_{mathrm{blood}}left(tright)={C}_{mathrm{blood}}left(0right){{rm{e}}}^{-{okay}_{{rm{e}}}t},$$

(7)

the place ({C}_{mathrm{blood}}left(0right)) is the preliminary focus of DNA origami within the blood. Equally, equation (5) yields the answer:

$${C}_{mathrm{peri}}left(tright)={C}_{mathrm{peri}}left(0right){{rm{e}}}^{-{okay}_{{rm{e}}}t},$$

(8)

the place ({C}_{mathrm{peri}}left(0right)) is the preliminary focus of DNA origami within the peritoneal cavity.

Substituting equation (8) for ({C}_{{rm{peri}}}) in equation (6) yields the non-homogeneous first-order linear differential equation:

$$frac{{rm{d}}{C}_{{rm{blood}}}}{{rm{d}}{t}}={okay}_{{rm{a}}}left(frac{{V}_{{rm{peri}}}}{{V}_{{rm{blood}}}}proper){C}_{{rm{peri}}}left(0right){{rm{e}}}^{-{okay}_{{rm{e}}}t}-{okay}_{{rm{e}}}{C}_{{rm{blood}}},$$

(9)

which, assuming zero preliminary focus within the blood, has the answer

$${C}_{{rm{blood}}}left(tright)={okay}_{{rm{a}}}left(frac{{V}_{{rm{peri}}}}{{V}_{{rm{blood}}}}proper)frac{{C}_{{rm{peri}}}left(0right)}{{okay}_{{rm{e}}}-{okay}_{{rm{a}}}}left({{rm{e}}}^{-{okay}_{{rm{a}}}t}-{{rm{e}}}^{-{okay}_{{rm{e}}}t}proper).$$

(10)

Equations (7), (8) and (10) allow the dynamic profiling of DNA origami concentrations of their respective compartments. The blood concentrations represented by equations (7) and (10) mirror values represented by experimental information, and had been fitted to every LSP trajectory by minimizing the residual sum of squares between the unique information and mannequin predictions:

$$mathrm{Loss}=mathop{sum }limits_{i=1}^{n}left(,{,y}_{i}-dot{{y}_{i}}proper),$$

(11)

the place (dot{{y}_{i}}) are the mannequin predictions, ({y}_{i}) are the person information factors and (n) is the variety of factors in an LSP trajectory. Goodness of match was assessed utilizing the coefficient of willpower:

$${R}^{2}=1-frac{{sum }_{i=1}^{n}{left({y}_{i}-dot{{y}_{i}}proper)}^{2}}{{sum }_{i=1}^{n}{left({y}_{i}-bar{{y}_{i}}proper)}^{2}},$$

(12)

the place (bar{{y}_{i}}) is the imply of the noticed information, and the basis imply sq. error (r.m.s.e.) is

$${rm{r}}.{rm{m}}.{rm{s}}.{rm{e}}.=sqrt{frac{1}{n}{sum }_{i=1}^{n}{left({y}_{i}-dot{{y}_{i}}proper)}^{2}}.$$

(13)

Reporting abstract

Additional data on analysis design is offered within the Nature Portfolio Reporting Abstract linked to this text.